Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120359 |
| Name | oriT_pSa1423-10K  |
| Organism | Salmonella sp. strain Sa1423 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MK356559 (3546..3604 [+], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_pSa1423-10K
GGGTTTCGGGGCGCAGCCCTGAACAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 20788 | GenBank | NZ_MK356559 |
| Plasmid name | pSa1423-10K | Incompatibility group | Col440II |
| Plasmid size | 10218 bp | Coordinate of oriT [Strand] | 3546..3604 [+] |
| Host baterium | Salmonella sp. strain Sa1423 |
Cargo genes
| Drug resistance gene | qnrS1 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |