Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120343 |
| Name | oriT_p2_21223 |
| Organism | Klebsiella quasipneumoniae strain 21223 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP091807 (25825..25874 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_p2_21223
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 25267..32607
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L7H25_RS26485 (L7H25_26480) | 21544..21900 | + | 357 | WP_004152717 | hypothetical protein | - |
| L7H25_RS26490 (L7H25_26485) | 21961..22173 | + | 213 | WP_004152718 | hypothetical protein | - |
| L7H25_RS26495 (L7H25_26490) | 22184..22408 | + | 225 | WP_004152719 | hypothetical protein | - |
| L7H25_RS26500 (L7H25_26495) | 22489..22809 | + | 321 | WP_004152720 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| L7H25_RS26505 (L7H25_26500) | 22799..23077 | + | 279 | WP_004152721 | helix-turn-helix transcriptional regulator | - |
| L7H25_RS26510 (L7H25_26505) | 23078..23491 | + | 414 | WP_023280875 | type II toxin-antitoxin system HigA family antitoxin | - |
| L7H25_RS26515 (L7H25_26510) | 24051..24878 | + | 828 | WP_023307552 | DUF932 domain-containing protein | - |
| L7H25_RS26520 (L7H25_26515) | 24905..25234 | + | 330 | WP_011977736 | DUF5983 family protein | - |
| L7H25_RS26525 (L7H25_26520) | 25267..25752 | - | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| L7H25_RS26530 (L7H25_26525) | 26187..26579 | + | 393 | WP_032436755 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| L7H25_RS26535 (L7H25_26530) | 26786..27481 | + | 696 | WP_023307551 | transcriptional regulator TraJ family protein | - |
| L7H25_RS26540 (L7H25_26535) | 27565..27936 | + | 372 | WP_004208838 | TraY domain-containing protein | - |
| L7H25_RS26545 (L7H25_26540) | 27990..28358 | + | 369 | WP_023307550 | type IV conjugative transfer system pilin TraA | - |
| L7H25_RS26550 (L7H25_26545) | 28372..28677 | + | 306 | WP_004178059 | type IV conjugative transfer system protein TraL | traL |
| L7H25_RS26555 (L7H25_26550) | 28697..29263 | + | 567 | WP_004152602 | type IV conjugative transfer system protein TraE | traE |
| L7H25_RS26560 (L7H25_26555) | 29250..29990 | + | 741 | WP_004152497 | type-F conjugative transfer system secretin TraK | traK |
| L7H25_RS26565 (L7H25_26560) | 29990..31414 | + | 1425 | WP_023307549 | F-type conjugal transfer pilus assembly protein TraB | traB |
| L7H25_RS26570 (L7H25_26565) | 31407..31826 | + | 420 | Protein_45 | conjugal transfer pilus-stabilizing protein TraP | - |
| L7H25_RS26575 (L7H25_26570) | 32038..32607 | + | 570 | WP_023307547 | type IV conjugative transfer system lipoprotein TraV | traV |
| L7H25_RS26580 (L7H25_26575) | 32739..33149 | + | 411 | WP_023307546 | hypothetical protein | - |
| L7H25_RS26585 (L7H25_26580) | 33154..33444 | + | 291 | WP_032423381 | hypothetical protein | - |
| L7H25_RS26590 (L7H25_26585) | 33468..33686 | + | 219 | WP_004171484 | hypothetical protein | - |
| L7H25_RS26595 (L7H25_26590) | 33687..34025 | + | 339 | WP_032436750 | hypothetical protein | - |
| L7H25_RS26600 (L7H25_26595) | 34070..34474 | + | 405 | WP_023307543 | hypothetical protein | - |
| L7H25_RS26605 (L7H25_26600) | 34471..34761 | + | 291 | WP_064185129 | hypothetical protein | - |
| L7H25_RS26610 (L7H25_26605) | 34769..35167 | + | 399 | WP_072158599 | hypothetical protein | - |
| L7H25_RS26615 (L7H25_26610) | 35239..35832 | + | 594 | Protein_54 | TraC family protein | - |
| L7H25_RS26620 (L7H25_26615) | 35896..36600 | + | 705 | WP_001067855 | IS6-like element IS26 family transposase | - |
| L7H25_RS26625 (L7H25_26620) | 36892..37449 | + | 558 | WP_001235713 | recombinase family protein | - |
Host bacterium
| ID | 20772 | GenBank | NZ_CP091807 |
| Plasmid name | p2_21223 | Incompatibility group | IncFIA |
| Plasmid size | 121831 bp | Coordinate of oriT [Strand] | 25825..25874 [-] |
| Host baterium | Klebsiella quasipneumoniae strain 21223 |
Cargo genes
| Drug resistance gene | blaTEM-1B, dfrA26, sul2, tet(D) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |