Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 120281
• Name: oriT_pWV01
• Organism: Lactococcus lactis
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NC_002192 (1868..1903 [+], 36 nt)
• oriT length: 36 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 36 nt

>oriT_pWV01
ACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 20710
• GenBank: NC_002192
• Plasmid name: pWV01
• Incompatibility group: -
• Plasmid size: 2178 bp
• Coordinate of oriT [Strand]: 1868..1903 [+]
• Host baterium: Lactococcus lactis

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -