Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120275
Name   oriT_pCFR-9161 in_silico
Organism   Citrobacter freundii complex sp. CFNIH3
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP026237 (125356..125640 [+], 285 nt)
oriT length   285 nt
IRs (inverted repeats)      184..189, 191..196  (AAAAGT..ACTTTT)
Location of nic site      109..110
Conserved sequence flanking the
  nic site  
 
 TTTGGTTAAA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 285 nt

>oriT_pCFR-9161
GGTTATTGCTACTTAATGCCGATAACGACTCAGGCTTTGAGGTTTTTTTATACGGTTCACATTTCGTTAGCAAGGTCAGGGTTTTTTGATAAAATTCTGGTTAGTTTGGTTAAAAAGTGTTACAAGTATGGGTAATGGCTGAAAGGTTAGTTTTAAGGTTCAAAGCGGCAGTATTAAAATTCCAAAAGTTACTTTTCATCCTTCAGAATCCAGACCTTAATTTCATGTAGAAGATTCGTACAATTGTATTGGCGCAAGGACAATCCGCACATGTCAGAATCAGAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20704 GenBank   NZ_CP026237
Plasmid name   pCFR-9161 Incompatibility group   IncFII
Plasmid size   235027 bp Coordinate of oriT [Strand]   125356..125640 [+]
Host baterium   Citrobacter freundii complex sp. CFNIH3

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   arsR, arsD, arsA, arsB, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -