Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120232
Name   oriT_pNFYY328-2 in_silico
Organism   Citrobacter freundii strain NFYY328
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP141647 (27605..27728 [+], 124 nt)
oriT length   124 nt
IRs (inverted repeats)      101..106, 119..124  (TTTAAT..ATTAAA)
 91..99, 113..121  (AATAATGTA..TACATTATT)
 90..95, 107..112  (AAATAA..TTATTT)
 39..46, 49..56  (GCAAAAAC..GTTTTTGC)
 3..10, 15..22  (TTGGTGGT..ACCACCAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 124 nt

>oriT_pNFYY328-2
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20661 GenBank   NZ_CP141647
Plasmid name   pNFYY328-2 Incompatibility group   IncR
Plasmid size   133774 bp Coordinate of oriT [Strand]   27605..27728 [+]
Host baterium   Citrobacter freundii strain NFYY328

Cargo genes


Drug resistance gene   blaTEM-1B, rmtB, blaSHV-12, blaKPC-2, blaCTX-M-65
Virulence gene   -
Metal resistance gene   merE, merD, merA, merP, merT, merR, pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, silA, silB, silF, silC, silR, silS, silE
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIE9