Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120174
Name   oriT_pUB110-protease in_silico
Organism   Bacillus velezensis isolate Pilsner2-2
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OU015478 (4650..4687 [-], 38 nt)
oriT length   38 nt
IRs (inverted repeats)      14..22, 29..37  (TAAAGTATA..TATACTTTA)
 2..8, 13..19  (ACTTTAT..ATAAAGT)
Location of nic site      27..28
Conserved sequence flanking the
  nic site  
 
 GTGTGTTATA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 38 nt

>oriT_pUB110-protease
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20604 GenBank   NZ_OU015478
Plasmid name   pUB110-protease Incompatibility group   -
Plasmid size   6756 bp Coordinate of oriT [Strand]   4650..4687 [-]
Host baterium   Bacillus velezensis isolate Pilsner2-2

Cargo genes


Drug resistance gene   aadD
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -