Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120171
Name   oriT_pAG001 in_silico
Organism   Psychromicrobium lacuslunae strain IHBB 11108
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP011006 (1695..1754 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pAG001
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20601 GenBank   NZ_CP011006
Plasmid name   pAG001 Incompatibility group   ColRNAI
Plasmid size   3716 bp Coordinate of oriT [Strand]   1695..1754 [-]
Host baterium   Psychromicrobium lacuslunae strain IHBB 11108

Cargo genes


Drug resistance gene   tet(C)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -