Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120164 |
| Name | oriT_p268-3  |
| Organism | Enterococcus faecium isolate 2014-VREF-268 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP019995 (42858..43034 [+], 177 nt) |
| oriT length | 177 nt |
| IRs (inverted repeats) | 91..97, 107..113 (ATTTTTT..AAAAAAT) 92..98, 105..111 (TTTTTTG..CAAAAAA) 26..34, 37..45 (CACCTTCCT..AGGAAGGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 177 nt
>oriT_p268-3
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGTGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGTGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 20594 | GenBank | NZ_CP019995 |
| Plasmid name | p268-3 | Incompatibility group | - |
| Plasmid size | 58211 bp | Coordinate of oriT [Strand] | 42858..43034 [+] |
| Host baterium | Enterococcus faecium isolate 2014-VREF-268 |
Cargo genes
| Drug resistance gene | VanHAX, aph(3')-III, erm(B) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |