Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120155
Name   oriT_BB1501_3 in_silico
Organism   Klebsiella quasipneumoniae isolate BB1501
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OV753638 (1559..1618 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_BB1501_3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20585 GenBank   NZ_OV753638
Plasmid name   BB1501_3 Incompatibility group   ColRNAI
Plasmid size   4783 bp Coordinate of oriT [Strand]   1559..1618 [-]
Host baterium   Klebsiella quasipneumoniae isolate BB1501

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -