Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120119
Name   oriT_p201903956-4 in_silico
Organism   Shigella sonnei strain 201903956
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OP038303 (2162..2221 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p201903956-4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20549 GenBank   NZ_OP038303
Plasmid name   p201903956-4 Incompatibility group   ColRNAI
Plasmid size   8401 bp Coordinate of oriT [Strand]   2162..2221 [+]
Host baterium   Shigella sonnei strain 201903956

Cargo genes


Drug resistance gene   sul2, aph(3'')-Ib, aph(6)-Id, tet(A)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -