Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120106
Name   oriT_pPOL9B in_silico
Organism   Enterobacter cloacae strain POL9
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP086410 (19819..19917 [-], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_pPOL9B
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20536 GenBank   NZ_CP086410
Plasmid name   pPOL9B Incompatibility group   IncR
Plasmid size   52962 bp Coordinate of oriT [Strand]   19819..19917 [-]
Host baterium   Enterobacter cloacae strain POL9

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -