Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 120097
• Name: oriT_p14154C
• Organism: Salmonella sp. SJTUF14154
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP064669 (4228..4287 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_p14154C
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 20527
• GenBank: NZ_CP064669
• Plasmid name: p14154C
• Incompatibility group: ColRNAI
• Plasmid size: 4936 bp
• Coordinate of oriT [Strand]: 4228..4287 [-]
• Host baterium: Salmonella sp. SJTUF14154

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -