Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120097
Name   oriT_p14154C in_silico
Organism   Salmonella sp. SJTUF14154
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP064669 (4228..4287 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p14154C
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20527 GenBank   NZ_CP064669
Plasmid name   p14154C Incompatibility group   ColRNAI
Plasmid size   4936 bp Coordinate of oriT [Strand]   4228..4287 [-]
Host baterium   Salmonella sp. SJTUF14154

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -