Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 120091
• Name: oriT_pColMG828
• Organism: Shigella sp. FC1139
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_MECX01000183 (393..465 [-], 73 nt)
• oriT length: 73 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 73 nt

>oriT_pColMG828
GTCGGGGTGAAGCCCTGACCAAGTGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 20521
• GenBank: NZ_MECX01000183
• Plasmid name: pColMG828
• Incompatibility group: Col
• Plasmid size: 975 bp
• Coordinate of oriT [Strand]: 393..465 [-]
• Host baterium: Shigella sp. FC1139

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -