Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120073 |
| Name | oriT_pKqs_SB610_6 |
| Organism | Klebsiella quasipneumoniae subsp. similipneumoniae strain SB610 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP084776 (33603..33651 [+], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_pKqs_SB610_6
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 27533..34209
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LGM29_RS29360 (LGM29_29360) | 22762..24789 | - | 2028 | Protein_24 | type IV secretion system protein TraC | - |
| LGM29_RS29365 (LGM29_29365) | 24861..25259 | - | 399 | WP_074194504 | hypothetical protein | - |
| LGM29_RS29370 (LGM29_29370) | 25441..25593 | - | 153 | WP_224518895 | hypothetical protein | - |
| LGM29_RS29375 (LGM29_29375) | 25636..26040 | - | 405 | WP_004197817 | hypothetical protein | - |
| LGM29_RS29380 (LGM29_29380) | 26107..26418 | - | 312 | WP_025712701 | hypothetical protein | - |
| LGM29_RS29385 (LGM29_29385) | 26419..26637 | - | 219 | WP_004195468 | hypothetical protein | - |
| LGM29_RS29390 (LGM29_29390) | 26661..26909 | - | 249 | WP_223175793 | hypothetical protein | - |
| LGM29_RS29395 (LGM29_29395) | 26980..27378 | - | 399 | WP_020277946 | hypothetical protein | - |
| LGM29_RS29400 (LGM29_29400) | 27533..28117 | - | 585 | WP_020277945 | type IV conjugative transfer system lipoprotein TraV | traV |
| LGM29_RS29405 (LGM29_29405) | 28191..29615 | - | 1425 | WP_015065626 | F-type conjugal transfer pilus assembly protein TraB | traB |
| LGM29_RS29410 (LGM29_29410) | 29615..30355 | - | 741 | WP_048235042 | type-F conjugative transfer system secretin TraK | traK |
| LGM29_RS29415 (LGM29_29415) | 30342..30908 | - | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| LGM29_RS29420 (LGM29_29420) | 30928..31233 | - | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| LGM29_RS29425 (LGM29_29425) | 31247..31615 | - | 369 | WP_004194426 | type IV conjugative transfer system pilin TraA | - |
| LGM29_RS29430 (LGM29_29430) | 31683..31883 | - | 201 | WP_046664192 | TraY domain-containing protein | - |
| LGM29_RS29435 (LGM29_29435) | 31969..32670 | - | 702 | WP_025712700 | hypothetical protein | - |
| LGM29_RS29440 (LGM29_29440) | 32900..33292 | - | 393 | WP_004194114 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| LGM29_RS29445 (LGM29_29445) | 33724..34209 | + | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| LGM29_RS29450 (LGM29_29450) | 34242..34571 | - | 330 | WP_011977736 | DUF5983 family protein | - |
| LGM29_RS29455 (LGM29_29455) | 34604..35425 | - | 822 | WP_032454971 | DUF932 domain-containing protein | - |
| LGM29_RS29460 (LGM29_29460) | 36108..36428 | - | 321 | WP_001568049 | hypothetical protein | - |
| LGM29_RS29465 (LGM29_29465) | 36463..36717 | - | 255 | WP_024191981 | DNA polymerase III subunit theta | - |
| LGM29_RS29470 (LGM29_29470) | 36905..37096 | - | 192 | WP_001568047 | hypothetical protein | - |
| LGM29_RS29475 (LGM29_29475) | 37139..37645 | - | 507 | WP_117139064 | antirestriction protein ArdA | - |
| LGM29_RS29480 (LGM29_29480) | 37688..38116 | - | 429 | WP_040088187 | antirestriction protein | - |
Host bacterium
| ID | 20503 | GenBank | NZ_CP084776 |
| Plasmid name | pKqs_SB610_6 | Incompatibility group | IncR |
| Plasmid size | 84354 bp | Coordinate of oriT [Strand] | 33603..33651 [+] |
| Host baterium | Klebsiella quasipneumoniae subsp. similipneumoniae strain SB610 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |