Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120070 |
| Name | oriT_pKqq_SB1124_8  |
| Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain SB1124 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP084814 (752..803 [+], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_pKqq_SB1124_8
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 20500 | GenBank | NZ_CP084814 |
| Plasmid name | pKqq_SB1124_8 | Incompatibility group | - |
| Plasmid size | 4937 bp | Coordinate of oriT [Strand] | 752..803 [+] |
| Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain SB1124 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |