Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 120069 |
Name | oriT_pKqq_SB1124_4 |
Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain SB1124 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP084810 (71797..71890 [+], 94 nt) |
oriT length | 94 nt |
IRs (inverted repeats) | 73..78, 84..89 (AAAAAA..TTTTTT) 28..34, 37..43 (GCGTGAT..ATCACGC) 13..19, 31..37 (TAAATCA..TGATTTA) |
Location of nic site | 55..56 |
Conserved sequence flanking the nic site |
GGTGTATAGC |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 94 nt
>oriT_pKqq_SB1124_4
TTTTTTTTCTTTTAAATCAGTGGTATGGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGGTATGGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 20499 | GenBank | NZ_CP084810 |
Plasmid name | pKqq_SB1124_4 | Incompatibility group | - |
Plasmid size | 84967 bp | Coordinate of oriT [Strand] | 71797..71890 [+] |
Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain SB1124 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |