Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120057 |
| Name | oriT_pKqs_09A323_3  |
| Organism | Klebsiella quasipneumoniae subsp. similipneumoniae strain 09A323 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP084786 (388..445 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pKqs_09A323_3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCAAATAGCACGTGCGGAGTGTATACGGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCAAATAGCACGTGCGGAGTGTATACGGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 20487 | GenBank | NZ_CP084786 |
| Plasmid name | pKqs_09A323_3 | Incompatibility group | Col440I |
| Plasmid size | 4425 bp | Coordinate of oriT [Strand] | 388..445 [+] |
| Host baterium | Klebsiella quasipneumoniae subsp. similipneumoniae strain 09A323 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |