Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120052 |
| Name | oriT_pKqq_18A069_2  |
| Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain 18A069 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP084820 (69605..69703 [-], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_pKqq_18A069_2
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 20482 | GenBank | NZ_CP084820 |
| Plasmid name | pKqq_18A069_2 | Incompatibility group | IncR |
| Plasmid size | 75062 bp | Coordinate of oriT [Strand] | 69605..69703 [-] |
| Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain 18A069 |
Cargo genes
| Drug resistance gene | sul1, qacE, ant(3'')-Ia |
| Virulence gene | - |
| Metal resistance gene | merE, merD, merA, merF, merP, merT, merR2 |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |