Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120000 |
| Name | oriT_pWW14A-7  |
| Organism | Klebsiella quasipneumoniae strain WW-14A |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP080105 (148..197 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 5..12, 15..22 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pWW14A-7
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTAAGTGGTGAG
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTAAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 20430 | GenBank | NZ_CP080105 |
| Plasmid name | pWW14A-7 | Incompatibility group | ColRNAI |
| Plasmid size | 3478 bp | Coordinate of oriT [Strand] | 148..197 [-] |
| Host baterium | Klebsiella quasipneumoniae strain WW-14A |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |