Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120000
Name   oriT_pWW14A-7 in_silico
Organism   Klebsiella quasipneumoniae strain WW-14A
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP080105 (148..197 [-], 50 nt)
oriT length   50 nt
IRs (inverted repeats)      5..12, 15..22  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 50 nt

>oriT_pWW14A-7
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTAAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20430 GenBank   NZ_CP080105
Plasmid name   pWW14A-7 Incompatibility group   ColRNAI
Plasmid size   3478 bp Coordinate of oriT [Strand]   148..197 [-]
Host baterium   Klebsiella quasipneumoniae strain WW-14A

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -