Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   119996
Name   oriT_FDAARGOS_1503|unnamed2 in_silico
Organism   Klebsiella quasipneumoniae strain FDAARGOS_1503
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP083635 (2595..2654 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_FDAARGOS_1503|unnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20426 GenBank   NZ_CP083635
Plasmid name   FDAARGOS_1503|unnamed2 Incompatibility group   Col440I
Plasmid size   4267 bp Coordinate of oriT [Strand]   2595..2654 [-]
Host baterium   Klebsiella quasipneumoniae strain FDAARGOS_1503

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -