Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119903 |
| Name | oriT_pNY1A  |
| Organism | Raoultella ornithinolytica strain NY1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP079753 (30705..30754 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pNY1A
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 20333 | GenBank | NZ_CP079753 |
| Plasmid name | pNY1A | Incompatibility group | IncFIB |
| Plasmid size | 167012 bp | Coordinate of oriT [Strand] | 30705..30754 [+] |
| Host baterium | Raoultella ornithinolytica strain NY1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE, arsR, arsD, arsA, arsB, arsC, arsH |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |