Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   119858
Name   oriT_pDY31-poxtA in_silico
Organism   Enterococcus casseliflavus strain DY31
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MW207674 (14240..14376 [+], 137 nt)
oriT length   137 nt
IRs (inverted repeats)     _
Location of nic site      104..105
Conserved sequence flanking the
  nic site  
 
 GCTTGCAGTA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 137 nt

>oriT_pDY31-poxtA
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTTCCCCTTTTCAAGCCACATTGTAATACAAATAACTTCGTTCTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATTTTCTATTTTGTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20288 GenBank   NZ_MW207674
Plasmid name   pDY31-poxtA Incompatibility group   -
Plasmid size   16483 bp Coordinate of oriT [Strand]   14240..14376 [+]
Host baterium   Enterococcus casseliflavus strain DY31

Cargo genes


Drug resistance gene   fexB, poxtA
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -