Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119679 |
| Name | oriT_pSEQU2  |
| Organism | Staphylococcus equorum UMC-CNS-924 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AVBD01000024 (5813..5913 [+], 101 nt) |
| oriT length | 101 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 101 nt
>oriT_pSEQU2
TCATCAGCCGAAACTTTGAATATGAGTGTGCCGAATTTCGTTAAGAAAAAGGCACATGGGAGTCGATTGGTAGCGCCCAAATTAGATAAAGAGACGCGACA
TCATCAGCCGAAACTTTGAATATGAGTGTGCCGAATTTCGTTAAGAAAAAGGCACATGGGAGTCGATTGGTAGCGCCCAAATTAGATAAAGAGACGCGACA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 20109 | GenBank | NZ_AVBD01000024 |
| Plasmid name | pSEQU2 | Incompatibility group | - |
| Plasmid size | 8832 bp | Coordinate of oriT [Strand] | 5813..5913 [+] |
| Host baterium | Staphylococcus equorum UMC-CNS-924 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |