Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119548 |
| Name | oriT_2023CK-01304|unnamed3  |
| Organism | Citrobacter amalonaticus strain 2023CK-01304 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP140492 (4168..4227 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_2023CK-01304|unnamed3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19978 | GenBank | NZ_CP140492 |
| Plasmid name | 2023CK-01304|unnamed3 | Incompatibility group | ColRNAI |
| Plasmid size | 4514 bp | Coordinate of oriT [Strand] | 4168..4227 [-] |
| Host baterium | Citrobacter amalonaticus strain 2023CK-01304 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |