Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119539 |
| Name | oriT_p4_020019  |
| Organism | Klebsiella variicola strain WCHKP19 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP028552 (649..698 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 6..12, 15..21 (CAAAATT..AATTTTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_p4_020019
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19969 | GenBank | NZ_CP028552 |
| Plasmid name | p4_020019 | Incompatibility group | Col440I |
| Plasmid size | 4686 bp | Coordinate of oriT [Strand] | 649..698 [+] |
| Host baterium | Klebsiella variicola strain WCHKP19 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |