Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119538 |
| Name | oriT_p3_020019  |
| Organism | Klebsiella variicola strain WCHKP19 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP028551 (14080..14175 [-], 96 nt) |
| oriT length | 96 nt |
| IRs (inverted repeats) | 74..79, 86..91 (AAAAAA..TTTTTT) 74..79, 85..90 (AAAAAA..TTTTTT) 28..35, 38..45 (AGCGTGAT..ATCACGCT) 14..20, 32..38 (TAAATCA..TGATTTA) |
| Location of nic site | 56..57 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 96 nt
>oriT_p3_020019
TTTTTTTTTATTTTAAATCAGTGGTATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTTATTTTAAATCAGTGGTATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19968 | GenBank | NZ_CP028551 |
| Plasmid name | p3_020019 | Incompatibility group | IncR |
| Plasmid size | 74191 bp | Coordinate of oriT [Strand] | 14080..14175 [-] |
| Host baterium | Klebsiella variicola strain WCHKP19 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | mrkA, mrkB, mrkC, mrkD, mrkF, mrkJ |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |