Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 119536
• Name: oriT_pMGD2
• Organism: Klebsiella sp. KCL-2
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NC_003789 (228..284 [-], 57 nt)
• oriT length: 57 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 57 nt

>oriT_pMGD2
GGGTTTCGGGGCGCACTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 19966
• GenBank: NC_003789
• Plasmid name: pMGD2
• Incompatibility group: Col
• Plasmid size: 3564 bp
• Coordinate of oriT [Strand]: 228..284 [-]
• Host baterium: Klebsiella sp. KCL-2

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -