Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   119443
Name   oriT_pA708-2 in_silico
Organism   Klebsiella quasipneumoniae strain A708
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP026370 (49811..49860 [+], 50 nt)
oriT length   50 nt
IRs (inverted repeats)      7..14, 17..24  (GCAAAATT..AATTTTGC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 TGTGTGGTGA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 50 nt

>oriT_pA708-2
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19873 GenBank   NZ_CP026370
Plasmid name   pA708-2 Incompatibility group   IncFIB
Plasmid size   118719 bp Coordinate of oriT [Strand]   49811..49860 [+]
Host baterium   Klebsiella quasipneumoniae strain A708

Cargo genes


Drug resistance gene   -
Virulence gene   mrkB, mrkC, mrkD, mrkF, mrkJ
Metal resistance gene   pcoE, pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, ncrC, nirB, ncrA
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIE9