Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119370 |
| Name | oriT_pRpKPC-2 |
| Organism | Raoultella planticola strain Rp_CZ180511 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP040185 (117292..117341 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pRpKPC-2
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 1..20323
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| FDZ05_RS28975 | 1..567 | + | 567 | WP_053390197 | type IV conjugative transfer system protein TraE | traE |
| FDZ05_RS28980 | 554..1288 | + | 735 | WP_053390198 | type-F conjugative transfer system secretin TraK | traK |
| FDZ05_RS28985 | 1288..2709 | + | 1422 | WP_075606927 | F-type conjugal transfer pilus assembly protein TraB | traB |
| FDZ05_RS28990 | 2702..3298 | + | 597 | WP_075606926 | conjugal transfer pilus-stabilizing protein TraP | - |
| FDZ05_RS28995 | 3321..3890 | + | 570 | WP_075606925 | type IV conjugative transfer system lipoprotein TraV | traV |
| FDZ05_RS29000 | 4002..4280 | + | 279 | WP_053390295 | hypothetical protein | - |
| FDZ05_RS29005 | 4287..4475 | + | 189 | WP_053390294 | hypothetical protein | - |
| FDZ05_RS30525 | 4559..4960 | + | 402 | WP_075606924 | hypothetical protein | - |
| FDZ05_RS29015 | 5414..5725 | + | 312 | WP_227524648 | hypothetical protein | - |
| FDZ05_RS29020 | 5818..8447 | + | 2630 | Protein_9 | type IV secretion system protein TraC | - |
| FDZ05_RS29025 | 8447..8836 | + | 390 | WP_180889148 | type-F conjugative transfer system protein TrbI | - |
| FDZ05_RS29030 | 8833..9459 | + | 627 | WP_180889149 | type-F conjugative transfer system protein TraW | traW |
| FDZ05_RS29035 | 9503..10462 | + | 960 | WP_088912317 | conjugal transfer pilus assembly protein TraU | traU |
| FDZ05_RS29040 | 10475..11101 | + | 627 | WP_075606921 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| FDZ05_RS29045 | 11098..13053 | + | 1956 | WP_075606920 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| FDZ05_RS29050 | 13085..13345 | + | 261 | WP_053390216 | hypothetical protein | - |
| FDZ05_RS29055 | 13338..13949 | + | 612 | WP_053390217 | hypothetical protein | - |
| FDZ05_RS29060 | 13939..14181 | + | 243 | WP_082226157 | conjugal transfer protein TrbE | - |
| FDZ05_RS29065 | 14227..14553 | + | 327 | WP_053390219 | hypothetical protein | - |
| FDZ05_RS29070 | 14574..15326 | + | 753 | WP_053390220 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| FDZ05_RS29075 | 15337..15573 | + | 237 | WP_053390221 | type-F conjugative transfer system pilin chaperone TraQ | - |
| FDZ05_RS29080 | 15548..16108 | + | 561 | WP_039698500 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| FDZ05_RS29085 | 16095..17465 | + | 1371 | WP_075606918 | conjugal transfer pilus assembly protein TraH | traH |
| FDZ05_RS29090 | 17465..20323 | + | 2859 | WP_180889150 | conjugal transfer mating-pair stabilization protein TraG | traG |
| FDZ05_RS29095 | 20340..21011 | + | 672 | WP_088883382 | hypothetical protein | - |
| FDZ05_RS30530 | 21257..21949 | + | 693 | WP_202395549 | hypothetical protein | - |
| FDZ05_RS29105 | 22068..24383 | + | 2316 | Protein_26 | type IV conjugative transfer system coupling protein TraD | - |
Host bacterium
| ID | 19800 | GenBank | NZ_CP040185 |
| Plasmid name | pRpKPC-2 | Incompatibility group | IncFII |
| Plasmid size | 120082 bp | Coordinate of oriT [Strand] | 117292..117341 [-] |
| Host baterium | Raoultella planticola strain Rp_CZ180511 |
Cargo genes
| Drug resistance gene | blaKPC-2 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |