Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   119370
Name   oriT_pRpKPC-2 in_silico
Organism   Raoultella planticola strain Rp_CZ180511
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP040185 (117292..117341 [-], 50 nt)
oriT length   50 nt
IRs (inverted repeats)      7..14, 17..24  (GCAAAATT..AATTTTGC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site    		  TGTGTGGTGA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 50 nt

>oriT_pRpKPC-2
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


T4SS

T4SS were predicted by using oriTfinder2.

Region 1: 1..20323

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
FDZ05_RS28975 1..567 + 567 WP_053390197 type IV conjugative transfer system protein TraE traE
FDZ05_RS28980 554..1288 + 735 WP_053390198 type-F conjugative transfer system secretin TraK traK
FDZ05_RS28985 1288..2709 + 1422 WP_075606927 F-type conjugal transfer pilus assembly protein TraB traB
FDZ05_RS28990 2702..3298 + 597 WP_075606926 conjugal transfer pilus-stabilizing protein TraP -
FDZ05_RS28995 3321..3890 + 570 WP_075606925 type IV conjugative transfer system lipoprotein TraV traV
FDZ05_RS29000 4002..4280 + 279 WP_053390295 hypothetical protein -
FDZ05_RS29005 4287..4475 + 189 WP_053390294 hypothetical protein -
FDZ05_RS30525 4559..4960 + 402 WP_075606924 hypothetical protein -
FDZ05_RS29015 5414..5725 + 312 WP_227524648 hypothetical protein -
FDZ05_RS29020 5818..8447 + 2630 Protein_9 type IV secretion system protein TraC -
FDZ05_RS29025 8447..8836 + 390 WP_180889148 type-F conjugative transfer system protein TrbI -
FDZ05_RS29030 8833..9459 + 627 WP_180889149 type-F conjugative transfer system protein TraW traW
FDZ05_RS29035 9503..10462 + 960 WP_088912317 conjugal transfer pilus assembly protein TraU traU
FDZ05_RS29040 10475..11101 + 627 WP_075606921 type-F conjugative transfer system pilin assembly protein TrbC trbC
FDZ05_RS29045 11098..13053 + 1956 WP_075606920 type-F conjugative transfer system mating-pair stabilization protein TraN traN
FDZ05_RS29050 13085..13345 + 261 WP_053390216 hypothetical protein -
FDZ05_RS29055 13338..13949 + 612 WP_053390217 hypothetical protein -
FDZ05_RS29060 13939..14181 + 243 WP_082226157 conjugal transfer protein TrbE -
FDZ05_RS29065 14227..14553 + 327 WP_053390219 hypothetical protein -
FDZ05_RS29070 14574..15326 + 753 WP_053390220 type-F conjugative transfer system pilin assembly protein TraF traF
FDZ05_RS29075 15337..15573 + 237 WP_053390221 type-F conjugative transfer system pilin chaperone TraQ -
FDZ05_RS29080 15548..16108 + 561 WP_039698500 type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB traF
FDZ05_RS29085 16095..17465 + 1371 WP_075606918 conjugal transfer pilus assembly protein TraH traH
FDZ05_RS29090 17465..20323 + 2859 WP_180889150 conjugal transfer mating-pair stabilization protein TraG traG
FDZ05_RS29095 20340..21011 + 672 WP_088883382 hypothetical protein -
FDZ05_RS30530 21257..21949 + 693 WP_202395549 hypothetical protein -
FDZ05_RS29105 22068..24383 + 2316 Protein_26 type IV conjugative transfer system coupling protein TraD -

Host bacterium

ID   19800 GenBank   NZ_CP040185
Plasmid name   pRpKPC-2 Incompatibility group   IncFII
Plasmid size   120082 bp Coordinate of oriT [Strand]   117292..117341 [-]
Host baterium   Raoultella planticola strain Rp_CZ180511

Cargo genes

Drug resistance gene   blaKPC-2
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -