Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119259 |
| Name | oriT_KNU07|unnamed  |
| Organism | Klebsiella michiganensis strain KNU07 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP041514 (141433..141482 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_KNU07|unnamed
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19689 | GenBank | NZ_CP041514 |
| Plasmid name | KNU07|unnamed | Incompatibility group | IncFII |
| Plasmid size | 203764 bp | Coordinate of oriT [Strand] | 141433..141482 [+] |
| Host baterium | Klebsiella michiganensis strain KNU07 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE, arsC, arsB, arsD, arsR, arsA, ncrA, ncrB, ncrC, ncrY |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |