Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119252 |
| Name | oriT_pET-ATCC-159-2 |
| Organism | Edwardsiella tarda ATCC 15947 = NBRC 105688 strain ATCC 15947 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP084507 (3599..3658 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pET-ATCC-159-2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19682 | GenBank | NZ_CP084507 |
| Plasmid name | pET-ATCC-159-2 | Incompatibility group | ColRNAI |
| Plasmid size | 6920 bp | Coordinate of oriT [Strand] | 3599..3658 [-] |
| Host baterium | Edwardsiella tarda ATCC 15947 = NBRC 105688 strain ATCC 15947 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |