Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   119252
Name   oriT_pET-ATCC-159-2 in_silico
Organism   Edwardsiella tarda ATCC 15947 = NBRC 105688 strain ATCC 15947
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP084507 (3599..3658 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pET-ATCC-159-2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19682 GenBank   NZ_CP084507
Plasmid name   pET-ATCC-159-2 Incompatibility group   ColRNAI
Plasmid size   6920 bp Coordinate of oriT [Strand]   3599..3658 [-]
Host baterium   Edwardsiella tarda ATCC 15947 = NBRC 105688 strain ATCC 15947

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -