Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   119249
Name   oriT_pX39-5 in_silico
Organism   Klebsiella variicola strain X39
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP023982 (2727..2784 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_pX39-5
GGGTTCGCGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGCATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19679 GenBank   NZ_CP023982
Plasmid name   pX39-5 Incompatibility group   ColRNAI
Plasmid size   3374 bp Coordinate of oriT [Strand]   2727..2784 [-]
Host baterium   Klebsiella variicola strain X39

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -