Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119237 |
| Name | oriT_FDAARGOS_511|unnamed2  |
| Organism | Klebsiella sp. FDAARGOS_511 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP033825 (1043..1093 [-], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_FDAARGOS_511|unnamed2
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGA
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19667 | GenBank | NZ_CP033825 |
| Plasmid name | FDAARGOS_511|unnamed2 | Incompatibility group | Col440I |
| Plasmid size | 3897 bp | Coordinate of oriT [Strand] | 1043..1093 [-] |
| Host baterium | Klebsiella sp. FDAARGOS_511 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |