Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119201 |
| Name | oriT_FDAARGOS_327|unnamed2  |
| Organism | Klebsiella aerogenes strain FDAARGOS_327 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP031758 (1986..2060 [-], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_FDAARGOS_327|unnamed2
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19631 | GenBank | NZ_CP031758 |
| Plasmid name | FDAARGOS_327|unnamed2 | Incompatibility group | ColRNAI |
| Plasmid size | 2938 bp | Coordinate of oriT [Strand] | 1986..2060 [-] |
| Host baterium | Klebsiella aerogenes strain FDAARGOS_327 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |