Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 119168
• Name: oriT_S44|unnamed4
• Organism: Advenella sp. S44
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_NEXS01000017 (1229..1280 [-], 52 nt)
• oriT length: 52 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 52 nt

>oriT_S44|unnamed4
AGCCTTTAAAGCGAAAATAGGGTACTCCATACTCGCTATATCGTCCCTGACA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 19598
• GenBank: NZ_NEXS01000017
• Plasmid name: S44|unnamed4
• Incompatibility group: -
• Plasmid size: 16182 bp
• Coordinate of oriT [Strand]: 1229..1280 [-]
• Host baterium: Advenella sp. S44

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -