Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 119160 |
Name | oriT_FDAARGOS_93|unnamed2 |
Organism | Klebsiella quasipneumoniae strain FDAARGOS_93 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP014073 (117420..117469 [+], 50 nt) |
oriT length | 50 nt |
IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
Location of nic site | 33..34 |
Conserved sequence flanking the nic site |
GGTGTGGTGA |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_FDAARGOS_93|unnamed2
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 19590 | GenBank | NZ_CP014073 |
Plasmid name | FDAARGOS_93|unnamed2 | Incompatibility group | IncFII |
Plasmid size | 151998 bp | Coordinate of oriT [Strand] | 117420..117469 [+] |
Host baterium | Klebsiella quasipneumoniae strain FDAARGOS_93 |
Cargo genes
Drug resistance gene | - |
Virulence gene | mrkA, mrkB, mrkC, mrkF, mrkJ |
Metal resistance gene | arsH, arsR, arsB, arsC, fecE, fecD, silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE, arsA, arsD, merR, merP, merC, merA, merD, merE |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |