Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   119160
Name   oriT_FDAARGOS_93|unnamed2 in_silico
Organism   Klebsiella quasipneumoniae strain FDAARGOS_93
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP014073 (117420..117469 [+], 50 nt)
oriT length   50 nt
IRs (inverted repeats)      7..14, 17..24  (GCAAAATT..AATTTTGC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GGTGTGGTGA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 50 nt

>oriT_FDAARGOS_93|unnamed2
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19590 GenBank   NZ_CP014073
Plasmid name   FDAARGOS_93|unnamed2 Incompatibility group   IncFII
Plasmid size   151998 bp Coordinate of oriT [Strand]   117420..117469 [+]
Host baterium   Klebsiella quasipneumoniae strain FDAARGOS_93

Cargo genes


Drug resistance gene   -
Virulence gene   mrkA, mrkB, mrkC, mrkF, mrkJ
Metal resistance gene   arsH, arsR, arsB, arsC, fecE, fecD, silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE, arsA, arsD, merR, merP, merC, merA, merD, merE
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -