Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   119142
Name   oriT_unnamed106 in_silico
Organism   Citrobacter sp. Res13-Lact-LER2-35-b
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JADAEO010000006 (419..478 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_unnamed106
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19572 GenBank   NZ_JADAEO010000006
Plasmid name   unnamed106 Incompatibility group   Col440II
Plasmid size   5113 bp Coordinate of oriT [Strand]   419..478 [+]
Host baterium   Citrobacter sp. Res13-Lact-LER2-35-b

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -