Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 119102
• Name: oriT_p202106367-6
• Organism: Shigella sonnei strain 202106367
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_OP038296 (7163..7222 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_p202106367-6
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 19534
• GenBank: NZ_OP038296
• Plasmid name: p202106367-6
• Incompatibility group: ColRNAI
• Plasmid size: 8379 bp
• Coordinate of oriT [Strand]: 7163..7222 [-]
• Host baterium: Shigella sonnei strain 202106367

Cargo genes

• Drug resistance gene: tet(A), aph(6)-Id, aph(3'')-Ib, sul2
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -