Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 119092 |
Name | oriT_p202108535-7 |
Organism | Shigella sonnei strain 202108535 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_OP038299 (4430..4489 [+], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_p202108535-7
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 19524 | GenBank | NZ_OP038299 |
Plasmid name | p202108535-7 | Incompatibility group | ColRNAI |
Plasmid size | 8375 bp | Coordinate of oriT [Strand] | 4430..4489 [+] |
Host baterium | Shigella sonnei strain 202108535 |
Cargo genes
Drug resistance gene | tet(A), sul2, aph(3'')-Ib, aph(6)-Id |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |