Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119085 |
| Name | oriT_p202108535-13  |
| Organism | Shigella sonnei strain 202108535 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OP038297 (2025..2081 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_p202108535-13
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19517 | GenBank | NZ_OP038297 |
| Plasmid name | p202108535-13 | Incompatibility group | Col440I |
| Plasmid size | 2699 bp | Coordinate of oriT [Strand] | 2025..2081 [-] |
| Host baterium | Shigella sonnei strain 202108535 |
Cargo genes
| Drug resistance gene | qnrB19 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |