Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   119084
Name   oriT_p202008118-16 in_silico
Organism   Shigella sonnei strain 202008118
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OP038286 (724..780 [+], 57 nt)
oriT length   57 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 57 nt

>oriT_p202008118-16
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19516 GenBank   NZ_OP038286
Plasmid name   p202008118-16 Incompatibility group   Col440I
Plasmid size   2579 bp Coordinate of oriT [Strand]   724..780 [+]
Host baterium   Shigella sonnei strain 202008118

Cargo genes


Drug resistance gene   qnrB19
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -