Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   119082
Name   oriT_p202008118-7 in_silico
Organism   Shigella sonnei strain 202008118
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OP038288 (4430..4489 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p202008118-7
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19514 GenBank   NZ_OP038288
Plasmid name   p202008118-7 Incompatibility group   ColRNAI
Plasmid size   8390 bp Coordinate of oriT [Strand]   4430..4489 [+]
Host baterium   Shigella sonnei strain 202008118

Cargo genes


Drug resistance gene   tet(A), sul2, aph(3'')-Ib, aph(6)-Id
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -