Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119063 |
| Name | oriT_pSO87_sm014  |
| Organism | Shigella sonnei strain ST152 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP140632 (983..1078 [-], 96 nt) |
| oriT length | 96 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 96 nt
>oriT_pSO87_sm014
CGGGGTGTCGGGTCGCAGCCCTGACCAGGTGGTAATCGGATGGCTGTGCGTGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGCGGGTTT
CGGGGTGTCGGGTCGCAGCCCTGACCAGGTGGTAATCGGATGGCTGTGCGTGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGCGGGTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19495 | GenBank | NZ_CP140632 |
| Plasmid name | pSO87_sm014 | Incompatibility group | Col |
| Plasmid size | 2330 bp | Coordinate of oriT [Strand] | 983..1078 [-] |
| Host baterium | Shigella sonnei strain ST152 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |