Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 119062
• Name: oriT_pSO87_sm013
• Organism: Shigella sonnei strain ST152
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP140631 (1393..1449 [+], 57 nt)
• oriT length: 57 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 57 nt

>oriT_pSO87_sm013
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 19494
• GenBank: NZ_CP140631
• Plasmid name: pSO87_sm013
• Incompatibility group: Col440I
• Plasmid size: 2579 bp
• Coordinate of oriT [Strand]: 1393..1449 [+]
• Host baterium: Shigella sonnei strain ST152

Cargo genes

• Drug resistance gene: qnrB19
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -