Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   119057
Name   oriT_pSO87_sm005 in_silico
Organism   Shigella sonnei strain ST152
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP140623 (407..466 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pSO87_sm005
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19489 GenBank   NZ_CP140623
Plasmid name   pSO87_sm005 Incompatibility group   ColRNAI
Plasmid size   8390 bp Coordinate of oriT [Strand]   407..466 [+]
Host baterium   Shigella sonnei strain ST152

Cargo genes


Drug resistance gene   sul2, aph(3'')-Ib, aph(6)-Id, tet(A)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -