Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119044 |
| Name | oriT_Dog032|unnamed1  |
| Organism | Staphylococcus aureus strain Dog032 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP120144 (7220..7406 [-], 187 nt) |
| oriT length | 187 nt |
| IRs (inverted repeats) | 147..154, 159..166 (CTATCATT..AATGATAG) 130..136, 140..146 (GTCTGGC..GCCAGAC) 64..71, 76..83 (GTGTCACA..TGTGACAC) 33..39, 44..50 (TGTCACA..TGTGACA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 187 nt
>oriT_Dog032|unnamed1
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAACTGTGACAAGCGCAATATATTGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATACTTAAAACCCTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAACTGTGACAAGCGCAATATATTGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATACTTAAAACCCTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19476 | GenBank | NZ_CP120144 |
| Plasmid name | Dog032|unnamed1 | Incompatibility group | - |
| Plasmid size | 33934 bp | Coordinate of oriT [Strand] | 7220..7406 [-] |
| Host baterium | Staphylococcus aureus strain Dog032 |
Cargo genes
| Drug resistance gene | blaZ |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |