Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119040 |
| Name | oriT_Dog139|unnamed1 |
| Organism | Staphylococcus aureus strain Dog139 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP120034 (26278..26466 [+], 189 nt) |
| oriT length | 189 nt |
| IRs (inverted repeats) | 149..156, 161..168 (CTATCATT..AATGATAG) 132..138, 142..148 (GTCTGGC..GCCAGAC) 64..71, 76..83 (GTGTCACA..TGTGACAC) 33..39, 44..50 (TGTCACA..TGTGACA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_Dog139|unnamed1
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAACTGTGACAAGCGCAATATATTGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAACTGTGACAAGCGCAATATATTGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19472 | GenBank | NZ_CP120034 |
| Plasmid name | Dog139|unnamed1 | Incompatibility group | - |
| Plasmid size | 33647 bp | Coordinate of oriT [Strand] | 26278..26466 [+] |
| Host baterium | Staphylococcus aureus strain Dog139 |
Cargo genes
| Drug resistance gene | blaZ |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |