Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   119036
Name   oriT_Dog140|unnamed1 in_silico
Organism   Staphylococcus aureus strain Dog140
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP120031 (15238..15425 [-], 188 nt)
oriT length   188 nt
IRs (inverted repeats)      148..155, 160..167  (CTATCATT..AATGATAG)
 131..137, 141..147  (GTCTGGC..GCCAGAC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 188 nt

>oriT_Dog140|unnamed1
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAGTAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19468 GenBank   NZ_CP120031
Plasmid name   Dog140|unnamed1 Incompatibility group   -
Plasmid size   41716 bp Coordinate of oriT [Strand]   15238..15425 [-]
Host baterium   Staphylococcus aureus strain Dog140

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21