Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 119033 |
| Name | oriT_Dog043|unnamed1  |
| Organism | Staphylococcus aureus strain Dog043 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP120135 (7258..7445 [-], 188 nt) |
| oriT length | 188 nt |
| IRs (inverted repeats) | 148..155, 160..167 (CTATCATT..AATGATAG) 131..137, 141..147 (GTCTGGC..GCCAGAC) 33..39, 44..50 (TGTCACA..TGTGACA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 188 nt
>oriT_Dog043|unnamed1
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAACTGTGACAAGCGCAATATATTGTGTCACAAAAGTGAGACACTACAGCTTTGTATGATATCACTTTAAAATACTTAAAACCCCTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAACTGTGACAAGCGCAATATATTGTGTCACAAAAGTGAGACACTACAGCTTTGTATGATATCACTTTAAAATACTTAAAACCCCTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19465 | GenBank | NZ_CP120135 |
| Plasmid name | Dog043|unnamed1 | Incompatibility group | - |
| Plasmid size | 33777 bp | Coordinate of oriT [Strand] | 7258..7445 [-] |
| Host baterium | Staphylococcus aureus strain Dog043 |
Cargo genes
| Drug resistance gene | blaZ |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |