Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 119031 |
Name | oriT_Dog132|unnamed1 |
Organism | Staphylococcus aureus strain Dog132 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP120051 (7183..7371 [-], 189 nt) |
oriT length | 189 nt |
IRs (inverted repeats) | 149..156, 161..168 (CTATCATT..AATGATAG) 132..138, 142..148 (GTCTGGC..GCCAGAC) 64..71, 76..83 (GTGTCACA..TGTGACAC) 33..39, 44..50 (TGTCACA..TGTGACA) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_Dog132|unnamed1
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAACTGTGACAAGCGCAATATATTGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAACTGTGACAAGCGCAATATATTGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 19463 | GenBank | NZ_CP120051 |
Plasmid name | Dog132|unnamed1 | Incompatibility group | - |
Plasmid size | 33649 bp | Coordinate of oriT [Strand] | 7183..7371 [-] |
Host baterium | Staphylococcus aureus strain Dog132 |
Cargo genes
Drug resistance gene | blaZ |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | AcrIIA21 |